Detail of EST/Unigene FS382975 |
Acc. | FS382975 |
Internal Acc. | FS382975 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=9e-86; Aspartate aminotransferase OS=Pinus pinaster E-value=9e-62; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=2e-60; Aspartate aminotransferase OS=Thermus aquaticus E-value=3e-34; Aspartate aminotransferase A OS=Rhizobium meliloti (strain 1021) E-value=2e-33; |
Length | 625 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GACCGCATCTTCGTCAAGAATTGCTTCAAGACCCTCCATTCCTCCTGGACTTCATTCTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.- 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816758 |
Trichome-related Gene from Literature | 816758 |