| Detail of EST/Unigene FS385248 |
| Acc. | FS385248 |
| Internal Acc. | FS385248 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=5e-65; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=1e-62; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-53; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-52; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=8e-52; |
| Length | 597 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GACACAATTTCAGCTCAAGTGTTCTTACTCTCTCATTCCATTTAGCTATGACTTATGCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |