| Detail of EST/Unigene FS392755 |
| Acc. | FS392755 |
| Internal Acc. | FS392755 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=1e-07; Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=7e-07; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=2e-06; |
| Length | 164 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GAGCACATTTACAAGTTAGAGCAGAAGAAGAAGAAGAAGAAAAGAGAGCATAGGAAATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844245 |
| Trichome-related Gene from Literature | N/A |