Detail of EST/Unigene FS392757 |
Acc. | FS392757 |
Internal Acc. | FS392757 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=1e-39; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=1e-14; Glutathione reductase, chloroplastic OS=Glycine max E-value=1e-12; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; Glutathione reductase, cytosolic OS=Pisum sativum E-value=5e-07; |
Length | 343 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GAGAAACGAACTGTTCGATTCCGCCAGCCATGGCTACATCTCTGAGCACACCAAAGCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824631 |
Trichome-related Gene from Literature | 824631 |