Detail of EST/Unigene FS393033 |
Acc. | FS393033 |
Internal Acc. | FS393033 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-53; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-48; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-47; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=4e-47; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-47; |
Length | 386 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GGTCACAACCAACTTTGACATCTCAAACCAGCAACCTCTCAATCACCTCCTGATAAACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |