Detail of EST/Unigene FS394313 |
Acc. | FS394313 |
Internal Acc. | FS394313 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-47; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=5e-47; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=2e-46; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=3e-46; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-44; |
Length | 406 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GATCACAACCAACTTTGACATCTCAAACCAGCAACCTCTCAATCACCTCCTGATAAACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |