| Detail of EST/Unigene FS398420 |
| Acc. | FS398420 |
| Internal Acc. | FS398420 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=3e-67; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=2e-64; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=3e-64; Shaggy-related protein kinase epsilon OS=Arabidopsis thaliana E-value=5e-60; Shaggy-related protein kinase alpha OS=Arabidopsis thaliana E-value=9e-60; |
| Length | 563 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GGCATGGCTGTTTTACATATGGGTCCTCTCTCTCTCTCTCCTCTAACCGACAATTATGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
| EC | 2.7.11.26 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827605 |
| Trichome-related Gene from Literature | 827605 |