| Detail of EST/Unigene FS401856 |
| Acc. | FS401856 |
| Internal Acc. | FS401856 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=4e-54; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=2e-53; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=8e-53; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=2e-52; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=5e-52; |
| Length | 551 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GGCTTACTGCTGGAGTCTGGACTGCTCTCTACTCCGTGCAACTTCTATGACTCTCCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |