| Detail of EST/Unigene FS402518 |
| Acc. | FS402518 |
| Internal Acc. | FS402518 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-59; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=1e-57; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=3e-26; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=7e-24; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=4e-19; |
| Length | 599 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GAGGGGTATCTTTTTGTGGGTAACTGCCAAACCACCACAAATTTTCAGTTCCCACTCTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827061 |
| Trichome-related Gene from Literature | 827061 |