Detail of EST/Unigene FS404600 |
Acc. | FS404600 |
Internal Acc. | FS404600 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=2e-68; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=1e-62; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=1e-62; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-62; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=2e-62; |
Length | 587 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GATCCAAAGGGCAGTAAAATATTGCCACACCTCTTTGTTATAAATTCTGAACTTTTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |