Detail of EST/Unigene FS406854 |
Acc. | FS406854 |
Internal Acc. | FS406854 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=2e-87; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-87; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=8e-87; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-87; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-77; |
Length | 655 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GATCTAACATCTCTATTACTTCAGCCATCAAAAAAACACTTACTTCTCCTTGCTAAACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |