| Detail of EST/Unigene FS420381 |
| Acc. | FS420381 |
| Internal Acc. | FS420381 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Psoralen synthase (Fragment) OS=Apium graveolens E-value=2e-28; Psoralen synthase OS=Ammi majus E-value=3e-27; Angelicin synthase (Fragment) OS=Pastinaca sativa E-value=5e-27; Cytochrome P450 750A1 OS=Pinus taeda E-value=3e-26; Psoralen synthase (Fragment) OS=Pastinaca sativa E-value=3e-26; |
| Length | 595 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GAGTAGTAGCAAAAAGGGGCTGTGAATTCCATCCATGGCTTCTCTTTGGCTAGCTCTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
| EC | 1.14.99.10 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835831 |
| Trichome-related Gene from Literature | N/A |