| Detail of EST/Unigene FS422067 |
| Acc. | FS422067 |
| Internal Acc. | FS422067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Fe], chloroplastic (Fragment) OS=Nicotiana plumbaginifolia E-value=5e-26; Superoxide dismutase [Fe], chloroplastic OS=Arabidopsis thaliana E-value=1e-19; Superoxide dismutase [Fe], chloroplastic OS=Glycine max E-value=2e-18; Superoxide dismutase [Fe] OS=Shigella flexneri E-value=6e-12; Superoxide dismutase [Fe] OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=6e-12; |
| Length | 230 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | ACAAGAGCCTACAATTGAGAACCCAAAAGAAACAGTTTGCAAGAAAAGCTGGTTCTGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.15.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835183 |
| Trichome-related Gene from Literature | N/A |