| Detail of EST/Unigene FS426334 |
| Acc. | FS426334 |
| Internal Acc. | FS426334 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-45; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-43; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=6e-14; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=2e-11; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=9e-08; |
| Length | 526 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954; |
| Sequence | GGAGGGGTATCTTTTTGTGGGTGACTGCCAAACCACCACAAATTTTCAGTTCCCACTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827061 |
| Trichome-related Gene from Literature | 827061 |