Detail of EST/Unigene FS426334 |
Acc. | FS426334 |
Internal Acc. | FS426334 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-45; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-43; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=6e-14; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=2e-11; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=9e-08; |
Length | 526 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GGAGGGGTATCTTTTTGTGGGTGACTGCCAAACCACCACAAATTTTCAGTTCCCACTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |