Detail of EST/Unigene FS426906 |
Acc. | FS426906 |
Internal Acc. | FS426906 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Psoralen synthase (Fragment) OS=Apium graveolens E-value=3e-27; Psoralen synthase OS=Ammi majus E-value=2e-26; Cytochrome P450 750A1 OS=Pinus taeda E-value=1e-25; Angelicin synthase (Fragment) OS=Pastinaca sativa E-value=1e-25; Cytochrome P450 71A6 (Fragment) OS=Nepeta racemosa E-value=2e-25; |
Length | 568 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GAGTAGTAGCAAAAAGGGGCTGTGAATTCCATCCATGGCTTCTCTTTGGCTAGCTCTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.99.10 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823989 |
Trichome-related Gene from Literature | N/A |