Detail of EST/Unigene FS431365 |
Acc. | FS431365 |
Internal Acc. | FS431365 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC7 OS=Arabidopsis thaliana E-value=2e-67; Rac-like GTP-binding protein 2 OS=Oryza sativa subsp. japonica E-value=2e-65; Rac-like GTP-binding protein 1 OS=Oryza sativa subsp. japonica E-value=6e-64; Rac-like GTP-binding protein 4 OS=Oryza sativa subsp. japonica E-value=4e-63; Rac-like GTP-binding protein ARAC10 OS=Arabidopsis thaliana E-value=1e-62; |
Length | 551 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | TGGGGGGTCCTGGTCCTCTCTCTACCTGTATCTTATTGTCTGTACTAACAAGGGGTCAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 829016 |
Trichome-related Gene from Literature | 829016 |