Detail of EST/Unigene GD185212 |
Acc. | GD185212 |
Internal Acc. | 501-2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Pisum sativum E-value=1e-14; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Arabidopsis thaliana E-value=8e-08; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=2e-07; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Spinacia oleracea E-value=7e-07; |
Length | 132 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | GGTAAATGGGAAAGGCTTTTCTGAATTCTCTGGTCTCCGTAACTCATCAGGATATCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822277 |
Trichome-related Gene from Literature | N/A |