| Detail of EST/Unigene GD185348 |
| Acc. | GD185348 |
| Internal Acc. | 160-2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nucleoside diphosphate kinase 4, chloroplastic OS=Spinacia oleracea E-value=4e-12; Nucleoside diphosphate kinase IV, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=4e-12; Nucleoside diphosphate kinase III, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=1e-11; Nucleoside diphosphate kinase 3 OS=Spinacia oleracea E-value=3e-11; Nucleoside diphosphate kinase OS=Microcystis aeruginosa (strain NIES-843) E-value=3e-08; |
| Length | 102 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | TCTCATCCTTTGCAGTCTCTGGACCATCGCTCCCATGGATGATATTTCTTCCAACAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.4.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828490 |
| Trichome-related Gene from Literature | N/A |