| Detail of EST/Unigene GD185501 |
| Acc. | GD185501 |
| Internal Acc. | 12-2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein THYLAKOID FORMATION1, chloroplastic OS=Solanum tuberosum E-value=4e-08; Protein THYLAKOID FORMATION1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-08; Protein THYLAKOID FORMATION 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-07; |
| Length | 107 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | AGTCCCCTCAACTTCTCCTTCTCTAGATGAAAACTCAATCAGAGAAGTCGCATTTTGAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816623 |
| Trichome-related Gene from Literature | N/A |