Detail of EST/Unigene GD185510 |
Acc. | GD185510 |
Internal Acc. | 220-2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Rattus norvegicus E-value=3e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Mus musculus E-value=3e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Pongo abelii E-value=4e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Homo sapiens E-value=4e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Cricetulus griseus E-value=4e-31; |
Length | 515 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | AGCAAAAGGAATAGGACGTACATAAATACACACCCAAAACTAATAGGATGCTATAAGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03014 DNA-directed RNA Polymerase II subunit F |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835269 |
Trichome-related Gene from Literature | N/A |