| Detail of EST/Unigene GD185510 |
| Acc. | GD185510 |
| Internal Acc. | 220-2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Rattus norvegicus E-value=3e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Mus musculus E-value=3e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Pongo abelii E-value=4e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Homo sapiens E-value=4e-31; DNA-directed RNA polymerases I, II, and III subunit RPABC2 OS=Cricetulus griseus E-value=4e-31; |
| Length | 515 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | AGCAAAAGGAATAGGACGTACATAAATACACACCCAAAACTAATAGGATGCTATAAGCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03014 DNA-directed RNA Polymerase II subunit F |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835269 |
| Trichome-related Gene from Literature | N/A |