| Detail of EST/Unigene GD185561 |
| Acc. | GD185561 |
| Internal Acc. | 451-2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-36; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-36; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=7e-36; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=9e-36; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=9e-36; |
| Length | 220 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | CCTTCAACTCTGCGAAAGCCTCTGGGTCGTCAGCTAGGCCCAATGGGTCAAAGCTGCCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |