Detail of EST/Unigene GD185601 |
Acc. | GD185601 |
Internal Acc. | 63-3 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translocase of chloroplast 132, chloroplastic OS=Arabidopsis thaliana E-value=8e-32; Translocase of chloroplast 120, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Translocase of chloroplast 159, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Translocase of chloroplast 90, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; |
Length | 206 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | GCCTTCATAACCCACATCATGATCCCAGCCGTGAGTTTCTAGGACAGGTCGTACAAGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
Probeset |
|
Corresponding NCBI Gene | 816165 |
Trichome-related Gene from Literature | N/A |