| Detail of EST/Unigene GD185601 |
| Acc. | GD185601 |
| Internal Acc. | 63-3 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translocase of chloroplast 132, chloroplastic OS=Arabidopsis thaliana E-value=8e-32; Translocase of chloroplast 120, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Translocase of chloroplast 159, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Translocase of chloroplast 90, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; |
| Length | 206 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | GCCTTCATAACCCACATCATGATCCCAGCCGTGAGTTTCTAGGACAGGTCGTACAAGCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
| Probeset |
|
| Corresponding NCBI Gene | 816165 |
| Trichome-related Gene from Literature | N/A |