| Detail of EST/Unigene GD185653 |
| Acc. | GD185653 |
| Internal Acc. | 393-3 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phytoene synthase, chloroplastic OS=Narcissus pseudonarcissus E-value=2e-18; Phytoene synthase, chloroplastic OS=Zea mays E-value=2e-18; Phytoene synthase, chloroplastic OS=Cucumis melo E-value=3e-18; Phytoene synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Phytoene synthase 1, chloroplastic OS=Solanum lycopersicum E-value=2e-17; |
| Length | 149 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | TGAACAGAGCAGATGGCCGGTGTGGGCGTCTTTGCTATTGTATCGACAAATATTGGACGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831587 |
| Trichome-related Gene from Literature | N/A |