Detail of EST/Unigene GD185653 |
Acc. | GD185653 |
Internal Acc. | 393-3 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene synthase, chloroplastic OS=Narcissus pseudonarcissus E-value=2e-18; Phytoene synthase, chloroplastic OS=Zea mays E-value=2e-18; Phytoene synthase, chloroplastic OS=Cucumis melo E-value=3e-18; Phytoene synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Phytoene synthase 1, chloroplastic OS=Solanum lycopersicum E-value=2e-17; |
Length | 149 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | TGAACAGAGCAGATGGCCGGTGTGGGCGTCTTTGCTATTGTATCGACAAATATTGGACGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831587 |
Trichome-related Gene from Literature | N/A |