Detail of EST/Unigene GD185742 |
Acc. | GD185742 |
Internal Acc. | 484-1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=4e-28; Plastocyanin OS=Vicia faba E-value=2e-23; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=6e-22; Plastocyanin, chloroplastic OS=Silene pratensis E-value=6e-22; Plastocyanin A, chloroplastic OS=Populus nigra E-value=6e-22; |
Length | 332 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | GGCAAACGCAAGCAAAGTTAGTGCCATAGCTAAGGTTCCAACTTTCAAATTCTCAATTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843942 |
Trichome-related Gene from Literature | N/A |