| Detail of EST/Unigene GD185752 |
| Acc. | GD185752 |
| Internal Acc. | 515-2R |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Violaxanthin de-epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=1e-37; Violaxanthin de-epoxidase, chloroplastic OS=Spinacia oleracea E-value=4e-36; Violaxanthin de-epoxidase, chloroplastic OS=Lactuca sativa E-value=2e-34; Violaxanthin de-epoxidase, chloroplastic OS=Nicotiana tabacum E-value=7e-33; |
| Length | 350 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | ACCCTTCTGCCAGCCTTTGTAACAAGGTCATTTCTGTTTTGCCAACCTTCTCCAAATCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837377 |
| Trichome-related Gene from Literature | N/A |