Detail of EST/Unigene GD185770 |
Acc. | GD185770 |
Internal Acc. | 291-2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein tumorous imaginal discs, mitochondrial OS=Drosophila virilis E-value=5e-12; DnaJ homolog subfamily A member 3, mitochondrial OS=Mus musculus E-value=7e-12; DnaJ homolog subfamily A member 3, mitochondrial OS=Homo sapiens E-value=7e-12; Chaperone protein DnaJ OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=3e-11; Protein tumorous imaginal discs, mitochondrial OS=Drosophila melanogaster E-value=2e-10; |
Length | 556 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | TTCAGGGTTCCCAAACTGATTGTATACTCTGGCTCTTCCAAAGTCTTCTTCAATTCCAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | MYB |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818875 |
Trichome-related Gene from Literature | N/A |