Detail of EST/Unigene GD185810 |
Acc. | GD185810 |
Internal Acc. | 158-2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Polyubiquitin 9 OS=Arabidopsis thaliana E-value=6e-13; Polyubiquitin 4 OS=Arabidopsis thaliana E-value=6e-13; Polyubiquitin 3 OS=Oryza sativa subsp. japonica E-value=6e-13; Polyubiquitin 3 OS=Arabidopsis thaliana E-value=6e-13; Polyubiquitin 14 OS=Arabidopsis thaliana E-value=6e-13; |
Length | 128 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_BML; |
Sequence | CAAGCACAAAGAGGGTATCCCTCCCTGATCAGCAGAGGCTTATCTTTGCAGGGAAACAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02927 large subunit ribosomal protein L40e; Genetic Information Processing > Translation > ko03010 Ribosome > K02977 small subunit ribosomal protein S27Ae |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832184 |
Trichome-related Gene from Literature | N/A |