| Detail of EST/Unigene GD185872 |
| Acc. | GD185872 |
| Internal Acc. | 429-2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=5e-21; Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=2e-19; Translation factor GUF1 homolog, chloroplastic OS=Physcomitrella patens subsp. patens E-value=3e-19; Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=4e-19; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=6e-19; |
| Length | 175 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_BML; |
| Sequence | AGCCCTCAGTGGCTTCTTTGATGTATCAGAAGGTGGGGGAACTCTTGCAACAATTGCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830766 |
| Trichome-related Gene from Literature | N/A |