| Detail of EST/Unigene GD249138 |
| Acc. | GD249138 |
| Internal Acc. | HLUTR3CH_T3_006_F12_27MAR2006_086 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U17 OS=Arabidopsis thaliana E-value=1e-41; Glutathione S-transferase U11 OS=Arabidopsis thaliana E-value=5e-41; Glutathione S-transferase U16 OS=Arabidopsis thaliana E-value=8e-37; Glutathione S-transferase U18 OS=Arabidopsis thaliana E-value=4e-36; Glutathione S-transferase U15 OS=Arabidopsis thaliana E-value=6e-34; |
| Length | 745 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HLUTR3CH; |
| Sequence | AGAAAGTTCCTGTCCTTATTCATGCAAATAAGCCCATTCCTGAATCTTTGGTTATCCTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837576 |
| Trichome-related Gene from Literature | N/A |