Detail of EST/Unigene GD251817 |
Acc. | GD251817 |
Internal Acc. | HLUTR3CH_T3_039_A09_23JUL2006_079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=7e-28; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=9e-23; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=4e-22; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=6e-16; |
Length | 744 nt |
Species | Humulus lupulus |
Belonged EST Libraries | HLUTR3CH; |
Sequence | AAATGCATACTAAGATGGCCGACAATAAGTTTCAACTTTTTACTATTCATGTCTTTAACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842869 |
Trichome-related Gene from Literature | 842869 |