| Detail of EST/Unigene GD251817 |
| Acc. | GD251817 |
| Internal Acc. | HLUTR3CH_T3_039_A09_23JUL2006_079 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=7e-28; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=9e-23; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=4e-22; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=6e-16; |
| Length | 744 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HLUTR3CH; |
| Sequence | AAATGCATACTAAGATGGCCGACAATAAGTTTCAACTTTTTACTATTCATGTCTTTAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842869 |
| Trichome-related Gene from Literature | 842869 |