| Acc. | GD252971 | 
  
 | Internal Acc. | HLUTR3CH_T3_052_B10_24JUL2006_078 | 
 
 | Type | EST | 
 
 | Annotation (Top 5 hits in Uniprot_trembl) | Phloroisovalerophenone synthase OS=Humulus lupulus E-value=5e-08; Chalcone synthase 1 OS=Gerbera hybrida E-value=7e-07; Chalcone synthase OS=Perilla frutescens E-value=2e-06; Chalcone synthase OS=Dianthus monspessulanus E-value=2e-06; Chalcone synthase OS=Antirrhinum majus E-value=2e-06; | 
 
 | Length | 209 nt | 
 
 | Species | Humulus lupulus | 
 
 | Belonged EST Libraries | HLUTR3CH; | 
 
 | Sequence | TGGGGCGCTCTCTTCGGGTTTGGACCGGGTCTGACGGTGGAGACGGTGGTCTTGCACAGCGTGCCCACCAACGTCTGATGAATGATTTGTTATCGCTAGCTTGTCAAATCAAGCTTTACT
 ATGTATTTCGGTCGTTAATTAGTTTATACTTTGATGTTGATCAATAATTATATACCTCAT
 CTAATAAAATGATCAAATATATTTATATA
 | 
 
 | EST members of Unigene | N/A | 
 
 | InterProScan Domain |  | 
  
 | Gene Ontology |  | 
  
 | KEGG Orthology |  | 
  
 | EC |  | 
  
 | Transcription Factor Family |  | 
  
 | Transporter Classification Family |  | 
  
 | Probeset | 
 
  | 
  
 | Corresponding NCBI Gene | 831241 | 
  
 | Trichome-related Gene from Literature | 831241 |