| Detail of EST/Unigene GO373617 |
| Acc. | GO373617 |
| Internal Acc. | ctsb5h2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cyclin-D3-1 OS=Arabidopsis thaliana E-value=9e-34; Cyclin-D3-2 OS=Arabidopsis thaliana E-value=2e-30; Cyclin-D3-3 OS=Arabidopsis thaliana E-value=4e-30; Putative cyclin-D2-3 OS=Oryza sativa subsp. japonica E-value=1e-11; Cyclin-D2-2 OS=Oryza sativa subsp. japonica E-value=3e-10; |
| Length | 804 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024456; |
| Sequence | GAGACTATACAGAGAATGGAACTCTTGGTGCTTTCTACTCTTAAGTGGAAAATGAATCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04503 cyclin D1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04503 cyclin D1; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K10151 cyclin D2; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K10151 cyclin D2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829564 |
| Trichome-related Gene from Literature | 829564 |