Detail of EST/Unigene GO602743 |
Acc. | GO602743 |
Internal Acc. | NBERO1CH_T3_028_H05_7JULY2006_033 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-1 OS=Nicotiana tabacum E-value=0; Hexokinase-2 OS=Solanum tuberosum E-value=0; Hexokinase-1 OS=Solanum tuberosum E-value=2e-90; Hexokinase-1 OS=Spinacia oleracea E-value=2e-86; Hexokinase-1 OS=Arabidopsis thaliana E-value=2e-81; |
Length | 703 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024542; |
Sequence | AGAAAGCGACGGTGGGAGCGGCCGTGGTTGGCGCCGCTACGGTATGTGCTGTGGCGGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 2.7.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829034 |
Trichome-related Gene from Literature | 829034 |