| Detail of EST/Unigene GO604868 |
| Acc. | GO604868 |
| Internal Acc. | NBERO1CH_T3_053_F02_02AUG2006_006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=5e-40; Trans-cinnamate 4-monooxygenase OS=Cicer arietinum E-value=6e-40; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=2e-39; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=2e-39; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=4e-39; |
| Length | 290 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542; |
| Sequence | TTAATTGGTCTTTTCTTTGCCATTTTAATCGCTTTAATAGTCTCTAAACTTCGTTCAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |