Detail of EST/Unigene GO607812 |
Acc. | GO607812 |
Internal Acc. | NBERO1CH_T3_088_H12_15JUL2006_082 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=9e-86; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=5e-73; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=6e-58; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=4e-32; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=4e-32; |
Length | 625 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024542; |
Sequence | CAATTTGTACTAAAAAATAATCTTGAGATCAAATGGAGAAAGCGATTGAGAGACAAAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |