Detail of EST/Unigene GT165076 |
Acc. | GT165076 |
Internal Acc. | M82T1_05_C14_M13R |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-99; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=2e-81; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=5e-63; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=5e-62; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=5e-62; |
Length | 785 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_025266; |
Sequence | CGATGGAAAAAAGAAAATCTTTATTAACTATGACGTTAAAAAGTAGTACACAACAACATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |