Detail of EST/Unigene GT166294 |
Acc. | GT166294 |
Internal Acc. | M82T1_07_G03_M13R |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=2e-18; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=1e-16; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=4e-14; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=5e-13; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=6e-13; |
Length | 312 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_025266; |
Sequence | GAAAAAAGGAACACTAAGTTTGTTTTGTAATAAAACTAAAAACATCACCAATTCACAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824287 |
Trichome-related Gene from Literature | 824287 |