Detail of EST/Unigene GT170450 |
Acc. | GT170450 |
Internal Acc. | LH__Ea03L21.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-18; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=2e-17; |
Length | 286 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LIBEST_025268; |
Sequence | GATGAAATTCAAATTTTGGGATTATTAATTAAGTTCTGAAAATATCCATGACCAAGAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |