Detail of EST/Unigene GT171852 |
Acc. | GT171852 |
Internal Acc. | LH__Ea0019F02.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-79; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-79; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-79; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=7e-79; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=7e-79; |
Length | 533 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LIBEST_025268; |
Sequence | ATATTGAAAAAAAATCCATTCTATTATCAAGTAAGTCACAACTACTTTACATGGCCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |