| Detail of EST/Unigene GT172746 |
| Acc. | GT172746 |
| Internal Acc. | LH__Ea0016O11.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=7e-50; Farnesyl pyrophosphate synthase 2 OS=Arabidopsis thaliana E-value=9e-50; Farnesyl pyrophosphate synthase 1, mitochondrial OS=Arabidopsis thaliana E-value=6e-49; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=2e-48; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=2e-48; |
| Length | 1145 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | LIBEST_025268; |
| Sequence | ACTAAAGGTGAAAAAGGATAAGAGTTTCCATTTCTTGGAAAAAAAAATAACAATTCATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |