| Detail of EST/Unigene GT174192 |
| Acc. | GT174192 |
| Internal Acc. | LH__Ea0012N22.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Hordeum vulgare E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=0; |
| Length | 1068 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | LIBEST_025268; |
| Sequence | GACAAGAACATGATTGATTGTTATTCAAGAGAATACTGATAAAAGAAATTAGGCGAATAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824287 |
| Trichome-related Gene from Literature | 824287 |