Detail of EST/Unigene GT177049 |
Acc. | GT177049 |
Internal Acc. | LH__Ea0019E18.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=8e-22; Hydroxymethylglutaryl-CoA synthase OS=Caenorhabditis elegans E-value=8e-06; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=1e-05; |
Length | 592 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LIBEST_025268; |
Sequence | AAAAAAAATGAAAATAAGTTCTTTCATTTCACAAATTTCAGCAATCACCCATTGAAATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |