| Detail of EST/Unigene GT178341 |
| Acc. | GT178341 |
| Internal Acc. | LH__Ea0014J03.r |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=4e-75; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-71; Lycopene beta cyclase, chloroplastic OS=Nicotiana tabacum E-value=1e-67; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=3e-63; Lycopene beta cyclase, chloroplastic OS=Arabidopsis thaliana E-value=3e-63; |
| Length | 1215 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | LIBEST_025268; |
| Sequence | GAGGCATCCATCCACCGGTTATATGGTGGCAAGGACACTAGCTGCAGCTCCTGTTGTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820185 |
| Trichome-related Gene from Literature | N/A |