Detail of EST/Unigene GT178341 |
Acc. | GT178341 |
Internal Acc. | LH__Ea0014J03.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=4e-75; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-71; Lycopene beta cyclase, chloroplastic OS=Nicotiana tabacum E-value=1e-67; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=3e-63; Lycopene beta cyclase, chloroplastic OS=Arabidopsis thaliana E-value=3e-63; |
Length | 1215 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LIBEST_025268; |
Sequence | GAGGCATCCATCCACCGGTTATATGGTGGCAAGGACACTAGCTGCAGCTCCTGTTGTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820185 |
Trichome-related Gene from Literature | N/A |