Detail of EST/Unigene GT179249 |
Acc. | GT179249 |
Internal Acc. | LH__Ea09K23.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=4e-82; Lichenase OS=Nicotiana plumbaginifolia E-value=2e-79; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=4e-78; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=5e-78; |
Length | 1002 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LIBEST_025268; |
Sequence | CAGTACTAATTAGGTTATTCAATCACCTTATATAAGCATGTAGGATGAGTACATATCACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |