| Detail of EST/Unigene GW328268 |
| Acc. | GW328268 |
| Internal Acc. | AAFB_UP_004_A07_07SEP2004_063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=8e-08; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-07; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-07; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-07; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-07; |
| Length | 198 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025692; |
| Sequence | GAACTTAAACCATTCTACATTTACTACAACATTCTCTAACCAAACCCACAAAAATGGCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |