Detail of EST/Unigene GW328268 |
Acc. | GW328268 |
Internal Acc. | AAFB_UP_004_A07_07SEP2004_063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=8e-08; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-07; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-07; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-07; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-07; |
Length | 198 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025692; |
Sequence | GAACTTAAACCATTCTACATTTACTACAACATTCTCTAACCAAACCCACAAAAATGGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |