| Detail of EST/Unigene GW329519 |
| Acc. | GW329519 |
| Internal Acc. | AAFB_UP_021_A08_06DEC2005_064 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-08; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-08; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-07; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=2e-07; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=5e-07; |
| Length | 170 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025692; |
| Sequence | GACAACACAAACAATCAAAGCATCTTCCAACCTACTTCAACCAATGGCTTCTTCAACCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |