Detail of EST/Unigene HO841319 |
Acc. | HO841319 |
Internal Acc. | NTZC-EST-0721 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=0; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=0; |
Length | 847 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_026713; |
Sequence | GAACCTGCAGAAAAACAGAACCACTGAAAGTGAAGACAAATATAAAGAGCTATCAAAAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |