Detail of EST/Unigene HO841948 |
Acc. | HO841948 |
Internal Acc. | NTZC-EST-1350 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=9e-94; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-82; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=4e-82; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=6e-82; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-81; |
Length | 710 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_026713; |
Sequence | GCTGCAAAAAACCTGAACCACTGAAAGTGAAGACAAATATAAAGAGCTATCAAAAGGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817548 |
Trichome-related Gene from Literature | N/A |