| Detail of EST/Unigene HS084482 |
| Acc. | HS084482 |
| Internal Acc. | ntb1423 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=1e-25; Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=4e-23; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=6e-22; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=6e-22; Ribosomal protein S14, mitochondrial OS=Prototheca wickerhamii E-value=4e-15; |
| Length | 641 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_026762; |
| Sequence | GACAGCAAATCGACTGGATTCGAACGAGCAAAAATGAACTCAATGGTGGCTTTAGTGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818015 |
| Trichome-related Gene from Literature | 818015 |