Detail of EST/Unigene HS084482 |
Acc. | HS084482 |
Internal Acc. | ntb1423 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=1e-25; Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=4e-23; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=6e-22; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=6e-22; Ribosomal protein S14, mitochondrial OS=Prototheca wickerhamii E-value=4e-15; |
Length | 641 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_026762; |
Sequence | GACAGCAAATCGACTGGATTCGAACGAGCAAAAATGAACTCAATGGTGGCTTTAGTGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |