Detail of EST/Unigene JK493947 |
Acc. | JK493947 |
Internal Acc. | CSATR1JP-T3-004_B17_3DEC2008_079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=2e-65; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=5e-65; Dihydroflavonol-4-reductase OS=Vitis vinifera E-value=1e-60; Dihydroflavonol-4-reductase OS=Callistephus chinensis E-value=9e-60; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=2e-59; |
Length | 464 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_027499; |
Sequence | TGTGACTGGGGCATCAGGTTTTATTGGTTCATGGCTCGTCAGGACACTTCTCCACCTCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.- 1.1.1.170 1.1.1.181 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834291 |
Trichome-related Gene from Literature | 834291 |